Genetic resources

PCR genotyping

Peromyscus

1. Tessier, N., Noël, S. and Lapointe, F.J., 2004. A new method to discriminate the deer mouse (Peromyscus maniculatus) from the white-footed mouse (Peromyscus leucopus) using species-specific primers in multiplex PCR. Canadian Journal of Zoology, 82(11), pp.1832-1835. Link
   • Tessier et al. primers
     • Reverse H9375 (5'-3'): ACTAAGAGAGTAGGATCCTCATCAATA
     • Forward P.mani-F-9197 (5'-3'): GGAATTTATGGGTCTACATTC
     • Forward P.leuco-F-9263 (5'-3'): CATTTCTAATAGTGTGCCTC
   • Notes
     • From Laura Steger: P. gossypinus produces a band similar to P. leucopus. P. polionotus produces a band similar to P. maniculatus. P. boylii may produce a single, double, or no band, depending on the locality. P. keeni produces a band similar to P. maniculatus.